Aligned Myoglobin Sequences

DNA sequencing gel Forward reaction DNA sequence (e value: 5e-44) GCCGTTGTTGAGTCGCAACAAAAAGCCCCCACCTTTCGGTGGGGGCTTTCCGATTCAACTGACGCTGAATCTTTTGGAGACTTCAGCCTCAGCCGATGGCG Reverse reaction DNA sequence (e value: 5e-44) GGCATCCGTGAGCCCGTCGCTGGCTCCCTGATCTACGGCAACAACATCATCTCCGGTGCTGTTGTGCCCTCCTCGAACGCCATCGGCCTTCACTTCTATCC The sequenced gene belongs to the psbA multigene family and codes for the D1 protein of photosystem II (PSII) in cyanobacteria such as Synechococcus WH7803. The D1 protein forms the core of the PSII’s reaction centre…

Read More

Cerebral Infarction of the Uygur and Han Ethnic Groups

Research Article   The Difference of the Polymorphism of RS4360791 Loci of ALOX5AP Gene between Cerebral Infarction of the Uygur andHan Ethnic Groups InXinjiang 1.       Abstract Objective:To explore the difference of the polymorphism of RS4360791 loci of ALOX5AP gene between cerebral infarction of the Uygur and Han ethnic groups in Xinjiang Province, China. Methods:This is…

Read More

Handroanthus impetiginosus (Mart. ex DC.) Mattos Analysis

Handroanthusimpetiginosus (Mart. ex DC.) Mattos “Ipê roxo”, “ipê rosa” or “pink lapacho” “Ipê roxo is a common name for Handroanthusimpeginosus. “Ipê” is a tupi[1] word that main “thick bark tree” and “roxo” is a Brazilian word for purple. Even the flowers being pink the most common name for the tree is purple ipê. The group of Ipês are broadly used in…

Read More

Effect of Exposure to Synthetic Estrogen on Fish Populations

The Effect of Exposure to Synthetic Estrogen on Fish Populations In a world full of pharmaceutical drugs and hormone replacement, pharmacists and toxicologists alike squabble with the implications of improper chemical disposal. Fewer professionals fully analyze how these chemicals are making it into the aquatic environment in ways other than improper disposal and to the…

Read More

Sexual and Asexual Reproduction in Plants

Compare and contrast sexual and asexual reproduction in plants and give medicinal plant examples. Introduction Plants are eukaryotic organisms that evolved over billions of years. There is enormous diversity in reproductive strategy in plants. Eukaryotes have nuclei in each cell that contain DNA coiled into chromosomes. Chromosomes are the organism’s reproductive functional unit and occur in single…

Read More

CGRP Receptor Activation Mechanism and Applications

CGRP Receptor activation Proposal Summary The calcitonin gene-related peptide (CGRP) receptor is a complex of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). This receptor plays an important role in vasodilation, neurogenic inflammation and is involved in the pathology of migraine. Though mechanisms have been proposed, it is largely unknown how exactly the…

Read More